MiRAlign



Input your sequence and parameters


please inpute your sequence here(sequence length should between 50~300)

Example sequence:
ccagccugcugaagcucagagggcucugauucagaaagaucaucggauccgucugagcuuggcuggucgg

Type: animal plant

  delta_len:  
min_seq_sim:
MFE:-kcal/mole

Supplementary