MiRAlign
Service
Supplementary Materials


MiRAlign

An online tool to identify homologous miRNA genes. This tool can search for new miRNA candidates by requiring structural similarity and sequence conservations between new candidates and experimentally identified miRNAs.



Input your sequence and parameters


please inpute your sequence here(sequence length should between 50~300)

Example sequence:
ccagccugcugaagcucagagggcucugauucagaaagaucaucggauccgucugagcuuggcuggucgg

Type:
animal plant
  delta_len:  
min_seq_sim:

MFE:-
kcal/mole